About   Help   FAQ
D11Mit48 Primer Detail
Primers
  • Name
    D11Mit48
  • Primer 1 Sequence
    TGAGCACACTTGCTGTGACA
  • Primer 2 Sequence
    CCAGGTCAGCGAGATGAAAT
  • ID
    MGI:706049
  • Product Size
    135
  • Other IDs
    D11Mit48 (BROAD)
  • Note
    MIT assay: B121
    Additional information: MIT STS Marker Data Files
Genes
D11Mit48 DNA segment, Chr 11, Massachusetts Institute of Technology 48
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit48 a 124bp SPRET/EiJ
b 128bp CAST/EiJ
c 130bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 136bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit48 l smaller LG/J
s larger SM/J
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit48 c lower CBA/Kw
k upper KE
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D11Mit48 b upper C57BL/6J
s lower 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory