About   Help   FAQ
Atp1b2-pA, Atp1b2-pB Primer Detail
Primers
  • Name
    Atp1b2-pA, Atp1b2-pB
  • Primer 1 Sequence
    TGGTGTTCCTGCCACAGAAA
  • Primer 2 Sequence
    TCTGAAGACAGCTACAGTGT
  • ID
    MGI:6542
Genes
Atp1b2 ATPase, Na+/K+ transporting, beta 2 polypeptide
Polymorphisms
J:29702 Santos J, et al., Cytogenet Cell Genet. 1995;71(3):223-4
Endonuclease Gene Allele Fragments Strains
Atp1b2 a 148bp CAST/EiJ
b 166bp C57BL/6J, M. m. domesticus
c 154bp CZECHII
m 138bp MOLF/EiJ
r 160bp RF/J
s 142bp SPRET/EiJ
J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76
Endonuclease Gene Allele Fragments Strains
Atp1b2 b larger C57BL/6J
r smaller RF/J
References
J:29702 Santos J, et al., Eight new polymorphic microsatellites in mouse gene loci. Cytogenet Cell Genet. 1995;71(3):223-4
J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory