About   Help   FAQ
Foxj1-pK, Foxj1-pL Primer Detail
Primers
  • Name
    Foxj1-pK, Foxj1-pL
  • Primer 1 Sequence
    CTTCTGCTACTTCCGCCATGC
  • Primer 2 Sequence
    TCCTCCTGGGTCAGCAGTAAGG
  • ID
    MGI:5823938
  • Region Covered
    exons 2-3
  • Synonyms
    Foxj1_ex2-3.for, Foxj1_ex2-3.rev
Genes
Foxj1 forkhead box J1
Expression
  • Assay Results
    74
References
J:237484 Weidemann M, et al., CFAP157 is a murine downstream effector of FOXJ1 that is specifically required for flagellum morphogenesis and sperm motility. Development. 2016 Dec 15;143(24):4736-4748
J:249115 Stauber M, et al., 1700012B09Rik, a FOXJ1 effector gene active in ciliated tissues of the mouse but not essential for motile ciliogenesis. Dev Biol. 2017 Sep 1;429(1):186-199
J:293391 Beckers A, et al., The FOXJ1 target Cfap206 is required for sperm motility, mucociliary clearance of the airways and brain development. Development. 2020 Jun 15;147(21):dev188052
J:307371 Beckers A, et al., The highly conserved FOXJ1 target CFAP161 is dispensable for motile ciliary function in mouse and Xenopus. Sci Rep. 2021 Jun 25;11(1):13333

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory