RIKEN clone 4022426M18 subclone Probe Detail MGI Mouse MGI:5001199

RIKEN clone 4022426M18 subclone Probe Detail

Name

RIKEN clone 4022426M18 subclone
Sequence Type

cDNA
ID

MGI:5001199
Region Covered

3' untranslated region of gene (nucleotides 512 - 1174 of AK132346.1)
Parent Clone

RIKEN clone 4022426M18
Insert Size

0.662kb
Note

This probe was generated via PCR using the following primer set: CCAGTGAAGCGAGTTTCTCC and CGATGTTAATACGACTCACTATAGGGCTCCTCTGTTTTGGCTCCTG. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
Synonyms

GUDMAP:13445 probe, GUDMAP:13515 probe, maprobe:5968

Sncaip

synuclein, alpha interacting protein (synphilin)

AK132346 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)

J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

J:177885 Brunskill EW, et al., Defining the molecular character of the developing and adult kidney podocyte. PLoS One. 2011;6(9):e24640

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23