About   Help   FAQ
29.MMUPAA Primer Detail
Primers
  • Name
    29.MMUPAA
  • Primer 1 Sequence
    TGCTGGCTAGGAATAAACAGA
  • Primer 2 Sequence
    AGGGAATTCATGTTCAGGATA
  • ID
    MGI:310
  • Product Size
    188bp
  • Synonyms
    29MMUPAA, MMUPAA
Genes
Plau plasminogen activator, urokinase
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Plau b smallest B6.PL-Thy1a, B10.H2nod, C57BL/6J
d larger DBA/2J
s smaller M. spretus, NOD, NON
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Plau a largest DBA/2J
a' largest DBA/2J
b 2nd largest NOD, NON, SPR
b' 2nd largest BALB/cCrc, CBA/CaH-T(14;15)6Ca, NOD/LtCrc
c 3rd largest B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7
c' 3rd largest C58, MEV/1TyJ
d' 4th largest A, B10.BR-H2k2 H2-T18a/SgSnJ, C3H/He
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Plau a largest DBA/2Pas, SEG/Pas, SPE/Pas
b 2nd largest 129S2/SvPas, BALB/cPas, DDK/Pas, SPR/Smh, STS/Pas
c 3rd largest C3H/HePas, C57BL/6Pas
d 4th largest PWK/Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Plau a largest BALB/cCrc, NOD/Crc, NZW/Ola
b larger C58/OlaCrc, CBA/CaCrc
c smaller A/JCrc, B10.D2-H2d/Nimr, C3H/HeCrc
d smallest AKR/Nimr, C57L/J
J:17613 Markel PD, et al., Mamm Genome. 1994 Apr;5(4):199-202
Endonuclease Gene Allele Fragments Strains
Plau l 192bp LS
s 182bp SS
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:17613 Markel PD, et al., Initial characterization of STS markers in the LSXSS series of recombinant inbred strains. Mamm Genome. 1994 Apr;5(4):199-202

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory