About   Help   FAQ
28.MMHSP68C Primer Detail
Primers
  • Name
    28.MMHSP68C
  • Primer 1 Sequence
    GTAATTGCGTTGACTGTTAAAT
  • Primer 2 Sequence
    AGTGCTGCTCCCAACATTACT
  • ID
    MGI:309
  • Product Size
    96bp
  • Synonyms
    28MMHSP68C, MMHSP68C
Genes
D17Nds2 DNA segment, Chr 17, Nuffield Department of Surgery 2
Hspa1b heat shock protein family A (Hsp70) member 1B
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Hspa1b b smaller B6.PL-Thy1a, C57BL/6J
d smallest DBA/2J, NON
n larger B10.H2nod, NOD
s largest M. spretus
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Hspa1b a largest SPR/Smh
b 2nd largest STS/Pas
c 3rd largest PWK/Pas
d 4th largest 129S2/SvPas, C57BL/6Pas, DDK/Pas
e 5th largest BALB/cPas, C3H/HePas, DBA/2Pas
f 6th largest SEG/Pas, SPE/Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Hspa1b a largest AKR/Nimr, BALB/cCrc, C57L/J, CBA/CaCrc
b larger A/JCrc, B10.D2-H2d/Nimr, C3H/HeCrc, C58/J, NOD/Crc
c smaller NZW/Ola
J:17315 Snoek M, et al., Mamm Genome. 1994 Mar;5(3):174-6
Endonuclease Gene Allele Fragments Strains
Hspa1b b 102bp b haplotype
d 96bp d haplotype, k haplotype
p 132bp p haplotype
q 104bp q haplotype
s 108bp s haplotype
x 122bp dx haplotype
z 114bp p2 haplotype
J:20144 Heine D, et al., Genomics. 1994 Sep 1;23(1):168-77
Endonuclease Gene Allele Fragments Strains
D17Nds2 b larger A.SW-H2s/Sn, B10.D2-Hc0 H2d H2-T18c/oSnJ
k smaller B10.K-H2k
p largest C3.NB-H2p, P/J
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
D17Nds2 n 121bp CTS/Shi, NOD/Shi
o 103bp NON/Shi
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Nds2 a 120bp BN/aW
b 110bp 129/SvW, C3H/W, C57BL/6W, C57BL/10W
c 105bp A.CA/W, AKR/W, BALB/cW, CBA/W, DBA/2W
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:4113 Snoek M, et al., Three Hsp70 genes are located in the C4-H-2D region: possible candidates for the Orch-1 locus [published erratum appears in Genomics 1993 Aug;17(2):533]. Genomics. 1993 Feb;15(2):350-6
J:17315 Snoek M, et al., New microsatellite size variants as markers for a cross-over hotspot in the C4-H-2D region. Mamm Genome. 1994 Mar;5(3):174-6
J:20144 Heine D, et al., Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics. 1994 Sep 1;23(1):168-77
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory