About   Help   FAQ
1.MMIGVH16 Primer Detail
Primers
  • Name
    1.MMIGVH16
  • Primer 1 Sequence
    ACATGGTAATTTATGGGCAA
  • Primer 2 Sequence
    CTGGATACCTGCAATAGTAGA
  • ID
    MGI:284
  • Product Size
    148bp
  • Synonyms
    1MMIGVH16, MMIGVH16
Genes
Igh-V immunoglobulin heavy chain variable region
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Igh-V b larger B6.PL-Thy1a, B10.H2nod, C57BL/6J, NOD
d smallest DBA/2J
n smaller M. spretus, NON
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Igh-V a largest B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7, NOD
a' largest NOD/LtCrc
b 2nd largest NON, SPR
b' 2nd largest BALB/cCrc, C58, MEV/1TyJ
c 3rd largest DBA/2J
c' 3rd largest A, DBA/2
d' 4th largest C3H/He, CBA/CaH-T(14;15)6Ca
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Igh-V a largest C57BL/6Pas
b 2nd largest 129S2/SvPas, BALB/cPas, DDK/Pas, SEG/Pas, SPE/Pas, SPR/Smh, STS/A
c 3rd largest DBA/2Pas, PWK/Pas
d 4th largest C3H/HePas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Igh-V a largest B10.D2-H2d/Nimr, NOD/Crc
b larger BALB/cCrc, C57BL/OlaCrc, C57L/J
c smaller A/JCrc
d smallest AKR/Nimr, C3H/HeCrc, CBA/CaCrc, NZW/Ola
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory