About   Help   FAQ
Fgf5-pC, Fgf5-pD Primer Detail
Primers
  • Name
    Fgf5-pC, Fgf5-pD
  • Primer 1 Sequence
    CATCTTCTGCAGCCACCTGATCCA
  • Primer 2 Sequence
    AAGTTCCGGTTGCTCGGACTGCTT
  • ID
    MGI:2664734
  • Region Covered
    Exons 1 and 3.
  • Product Size
    652bp
Genes
Fgf5 fibroblast growth factor 5
Expression
  • Assay Results
    13
References
J:35179 Ozawa K, et al., Expression of the fibroblast growth factor family and their receptor family genes during mouse brain development. Brain Res Mol Brain Res. 1996 Sep 5;41(1-2):279-88
J:45221 Ozawa K, et al., A quantitative method for evaluation of FGF family and FGF receptor family gene expression by RT-PCR. Brain Res Brain Res Protoc. 1997 Aug;1(3):211-6
J:50598 Ozawa K, et al., An alternatively spliced fibroblast growth factor (FGF)-5 mRNA is abundant in brain and translates into a partial agonist/antagonist for FGF-5 neurotrophic activity. J Biol Chem. 1998 Oct 30;273(44):29262-71
J:76230 Hajihosseini MK, et al., Expression patterns of fibroblast growth factors-18 and -20 in mouse embryos is suggestive of novel roles in calvarial and limb development. Mech Dev. 2002 Apr;113(1):79-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory