About   Help   FAQ
Raldh2-pA, Raldh2-pB Primer Detail
Primers
  • Name
    Raldh2-pA, Raldh2-pB
  • Primer 1 Sequence
    TTGCAGATGCTGACTTGGAC
  • Primer 2 Sequence
    TCTGAGGACCCTGCTCAGTT
  • ID
    MGI:1926899
Genes
Aldh1a2 aldehyde dehydrogenase family 1, subfamily A2
Expression
  • Assay Results
    13
References
J:61711 Ulven SM, et al., Identification of endogenous retinoids, enzymes, binding proteins, and receptors during early postimplantation development in mouse: important role of retinal dehydrogenase type 2 in synthesis of all-trans-retinoic acid. Dev Biol. 2000 Apr 15;220(2):379-91
J:72547 Ulven SM, et al., Quantitative axial profiles of retinoic acid in the embryonic mouse spinal cord: 9-cis retinoic acid only detected after all-trans-retinoic acid levels are super-elevated experimentally. Dev Dyn. 2001 Nov;222(3):341-53
J:75953 Wei L, et al., Inhibition of Rho family GTPases by Rho GDP dissociation inhibitor disrupts cardiac morphogenesis and inhibits cardiomyocyte proliferation. Development. 2002 Apr;129(7):1705-14
J:132367 Kim YK, et al., Retinyl ester formation by lecithin: retinol acyltransferase is a key regulator of retinoid homeostasis in mouse embryogenesis. J Biol Chem. 2008 Feb 29;283(9):5611-21

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory