About   Help   FAQ
Mest-pA, Mest-pB Primer Detail
Primers
  • Name
    Mest-pA, Mest-pB
  • Primer 1 Sequence
    ATTCGCAACAATGACGGC
  • Primer 2 Sequence
    TGAGGTGGACTATTGTGTCACC
  • ID
    MGI:1267018
  • Region Covered
    3' coding region (291 bp) and 3' untranslated region (196 bp)
  • Synonyms
    Peg1-pA, Peg1-pB, Peg1/Mest-pE, Peg1/Mest-pF
Genes
Mest mesoderm specific transcript
Expression
  • Assay Results
    48
References
J:28395 Kaneko-Ishino T, et al., Peg1/Mest imprinted gene on chromosome 6 identified by cDNA subtraction hybridization. Nat Genet. 1995 Sep;11(1):52-9
J:47783 Obata Y, et al., Disruption of primary imprinting during oocyte growth leads to the modified expression of imprinted genes during embryogenesis. Development. 1998 Apr;125(8):1553-60
J:47969 Schuster-Gossler K, et al., The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA. Dev Dyn. 1998 Jun;212(2):214-28
J:48293 Reule M, et al., Analysis of Peg1/Mest imprinting in the mouse. Dev Genes Evol. 1998 May;208(3):161-3
J:61969 Miyoshi N, et al., Identification of an imprinted gene, Meg3/Gtl2 and its human homologue MEG3, first mapped on mouse distal chromosome 12 and human chromosome 14q. Genes Cells. 2000 Mar;5(3):211-20
J:74103 Kobayashi S, et al., Mouse Peg9/Dlk1 and human PEG9/DLK1 are paternally expressed imprinted genes closely located to the maternally expressed imprinted genes: mouse Meg3/Gtl2 and human MEG3. Genes Cells. 2000 Dec;5(12):1029-37

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory