Tmem144^em1Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem144^em1Osb
• Name: transmembrane protein 144; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
• MGI ID: MGI:8475113
• Gene: Tmem144 Location: Chr3:79719871-79760080 bp, - strand Genetic Position: Chr3, 35.07 cM, cytoband F1
• Alliance: Tmem144^em1Osb page

Mutation origin

• Strain of Origin: (C57BL/6NCrSlc x DBA/2CrSlc)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  CRISPR/Cas9-mediated recombination generated a 19,945 bp deletion of exons 4 to 11 using gRNAs ATTTAACACCTTAACTGGCT and GCTGCGCAAGCTAACACTAC. (J:392877)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem144 Mutation: 34 strains or lines available

References

• Original: J:392877 Takemoto K, et al., Functional analysis of genes enriched in male reproductive organs: validation via fertility assessment of 14 knockout mouse lines. Front Cell Dev Biol. 2026;14:1851315
• All: 1 reference(s)