Nans^em1Xce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nans^em1Xce
• Name: N-acetylneuraminic acid synthase (sialic acid synthase); endonuclease-mediated mutation 1, Xiaobo Cen
• MGI ID: MGI:8459976
• Gene: Nans Location: Chr4:46489319-46503439 bp, + strand Genetic Position: Chr4, 24.83 cM, cytoband B2
• Alliance: Nans^em1Xce page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  CRISPR/Cas9-mediated recombination targeting exons 1 and 6 using sgRNAs CGGCGGGTGCGGAAACGCCCGGG and GACTGGCTGCTAAGAACCGTAGG generated a 13,745 bp deletion of exons 1-6. (J:343080)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nans Mutation: 20 strains or lines available

References

• Original: J:343080 Bu Q, et al., Neurodevelopmental defects in human cortical organoids with N-acetylneuraminic acid synthase mutation. Sci Adv. 2023 Nov 24;9(47):eadf2772
• All: 1 reference(s)