Ncstn^em1Btlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncstn^em1Btlr
• Name: nicastrin; endonuclease-mediated mutation 1, Bruce Beutler
• MGI ID: MGI:8409915
• Synonyms: Ncstn^V439G
• Gene: Ncstn Location: Chr1:171893580-171910356 bp, - strand Genetic Position: Chr1, 79.54 cM
• Alliance: Ncstn^em1Btlr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Single point mutation
• Mutation details:

  Valine codon 439 (GTC) was changed to glycine (GGC) (p.V439G) using an sgRNA (equivalent to GGCTCGAAACATCTCTGGCG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the DAP domain of the encoded protein, affects its glycosylation and leads to impaired B cell development, increased susceptibility to induced colitis and hypopigmentation. (J:285752)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ncstn Mutation: 36 strains or lines available

References

• Original: J:285752 Choi JH, et al., Essential requirement for nicastrin in marginal zone and B-1 B cell development. Proc Natl Acad Sci U S A. 2020 Mar 3;117(9):4894-4901
• All: 1 reference(s)