About   Help   FAQ
Nat10em1Meij
Endonuclease-mediated Allele Detail
Summary
Symbol: Nat10em1Meij
Name: N-acetyltransferase 10; endonuclease-mediated mutation 1, Jordan L Meier
MGI ID: MGI:8404130
Synonyms: Nat10 H537A
Gene: Nat10  Location: Chr2:103551601-103591615 bp, - strand  Genetic Position: Chr2, 54.43 cM
Alliance: Nat10em1Meij page
Mutation
origin
Strain of Origin:  C57BL/6NCr
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Nucleotide substitutions
 
Mutation details: 

Generated by CRISPR/Cas9 in zygotes by pronuclear microinjection of Cas9 protein with two in vitro transcribed guide RNAs and a long single-stranded DNA donor. Guides: GGCCTTGTGGTAGCAAAAGA (PAM GGG, cutting within codon 516 of exon 15) and GACAGGGAACCTCTCCAGTA (PAM AGG, cutting in the downstream intron). The donor was designed to introduce c.1609_1610delinsGC (p.His537Ala) plus PAM-disrupting substitutions at both cut sites. (J:391371)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nat10 Mutation:  74 strains or lines available
Notes
NOTE FOR USERS: routine allele-specific PCR genotyping at codon 537 does not detect p.Phe516del as the 3-bp difference is not resolvable on the standard 215-bp genotyping amplicon.
References
Original:  J:391371 Meier J, Direct Data Submission for Nat10. MGI Direct Data Submission. 2026;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory