Nat10^em1Meij
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nat10^em1Meij
• Name: N-acetyltransferase 10; endonuclease-mediated mutation 1, Jordan L Meier
• MGI ID: MGI:8404130
• Synonyms: Nat10 H537A
• Gene: Nat10 Location: Chr2:103551601-103591615 bp, - strand Genetic Position: Chr2, 54.43 cM
• Alliance: Nat10^em1Meij page

Mutation origin

• Strain of Origin: C57BL/6NCr

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details:

  Generated by CRISPR/Cas9 in zygotes by pronuclear microinjection of Cas9 protein with two in vitro transcribed guide RNAs and a long single-stranded DNA donor. Guides: GGCCTTGTGGTAGCAAAAGA (PAM GGG, cutting within codon 516 of exon 15) and GACAGGGAACCTCTCCAGTA (PAM AGG, cutting in the downstream intron). The donor was designed to introduce c.1609_1610delinsGC (p.His537Ala) plus PAM-disrupting substitutions at both cut sites. (J:391371)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nat10 Mutation: 74 strains or lines available

Notes

NOTE FOR USERS: routine allele-specific PCR genotyping at codon 537 does not detect p.Phe516del as the 3-bp difference is not resolvable on the standard 215-bp genotyping amplicon.

References

• Original: J:391371 Meier J, Direct Data Submission for Nat10. MGI Direct Data Submission. 2026
• All: 1 reference(s)