Usp7^em1Gno
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usp7^em1Gno
• Name: ubiquitin specific peptidase 7; endonuclease-mediated mutation 1, Gaia Novarino
• MGI ID: MGI:8395601
• Gene: Usp7 Location: Chr16:8506586-8574931 bp, - strand Genetic Position: Chr16, 4.28 cM
• Alliance: Usp7^em1Gno page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details:

  CRISPR/Cas9-mediated recombination using sgRNAs CTCTCCCGAACATTATGAAG AGG and TGCCACGTCTTATACACATT AGG targeting intronic regions flanking exon 6 generated a loss-of-function mutation. (J:389441)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Usp7 Mutation: 63 strains or lines available

References

• Original: J:389441 Schwarz LA, et al., Cortical development dynamics across autism spectrum disorder mouse models. Nature. 2026 Jun 17
• All: 1 reference(s)