Ajap1^em1Bet
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ajap1^em1Bet
• Name: adherens junction associated protein 1; endonuclease-mediated mutation 1, Bernhard Bettler
• MGI ID: MGI:8377433
• Synonyms: Ajap1^W183C
• Gene: Ajap1 Location: Chr4:153457678-153567268 bp, - strand Genetic Position: Chr4, 83.71 cM
• Alliance: Ajap1^em1Bet page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Dominant negative, Humanized sequence)
• Mutation: Single point mutation
• Mutation details:

  Tryptophan codon 183 (TGG) in exon 2 was changed to cysteine (TGC) (p.W183C) using an sgRNA (targeting CTCATCCCCCGTAGGCCCCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in an individual suffering from epilepsy and in mice results in synaptic dysfunctions. (J:388888)

• Inheritance: Dominant

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ajap1 Mutation: 17 strains or lines available

References

• Original: J:388888 Fruh S, et al., Monoallelic de novo AJAP1 loss-of-function variants disrupt trans-synaptic control of neurotransmitter release. Sci Adv. 2024 Jul 12;10(28):eadk5462
• All: 1 reference(s)