Mettl3^em1Sxiao
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mettl3^em1Sxiao
• Name: methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit; endonuclease-mediated mutation 1, Shan Xiao
• MGI ID: MGI:8352302
• Synonyms: Mettl3^K480R
• Gene: Mettl3 Location: Chr14:52532298-52542585 bp, - strand Genetic Position: Chr14, 26.88 cM, cytoband C1
• Alliance: Mettl3^em1Sxiao page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Lysine codon 480 (AAG) was changed to arginine (CGC) (p.K480R) using an sgRNA (equivalent to TCACTGGTTAAACCACGGGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the c.1439A>G p.K480R human mutation associated with Parkinson's Disease (PD) and in heterozygous mice causes a similar phenotype. (J:385020)

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mettl3 Mutation: 45 strains or lines available

References

• Original: J:385020 Liu S, et al., m6A deficiency induces dopaminergic neurodegeneration and progressive parkinsonism through a pathogenic loop with mitochondria. J Clin Invest. 2026 May 1;136(9)
• All: 1 reference(s)