About   Help   FAQ
Gpx4em1Marc
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpx4em1Marc
Name: glutathione peroxidase 4; endonuclease-mediated mutation 1, Marcus Conrad
MGI ID: MGI:8350465
Synonyms: Gpx4R152H
Gene: Gpx4  Location: Chr10:79883000-79892273 bp, + strand  Genetic Position: Chr10, 39.72 cM
Alliance: Gpx4em1Marc page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation details: 

Arginine codon 152 (CGC) was changed to histidine (CAT) (p.R152H) using sgRNAs (equivalent to AGTTAACAGACTTTCGGTGCTGG, GGTGACTACCTACGGTGAGTAGG, AATTGGAGTTAACAGACTTTCGG and CCACTCTACCTACTCACCGTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Sedaghatian-type spondylometaphy-seal dysplasia (SSMD). Homozygosity for this allele is embryonic lethal. Compound heterozygosity with an inducible conditional KO allele leads to renal failure (whole body KO) or progressive cortical neurodegeneration (glutamatergic neuron-specific KO). (J:385850)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gpx4 Mutation:  80 strains or lines available
References
Original:  J:385850 Lorenz SM, et al., A fin-loop-like structure in GPX4 underlies neuroprotection from ferroptosis. Cell. 2025 Dec 4;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory