Gpx4^em1Marc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpx4^em1Marc
• Name: glutathione peroxidase 4; endonuclease-mediated mutation 1, Marcus Conrad
• MGI ID: MGI:8350465
• Synonyms: Gpx4^R152H
• Gene: Gpx4 Location: Chr10:79883000-79892273 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Gpx4^em1Marc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 152 (CGC) was changed to histidine (CAT) (p.R152H) using sgRNAs (equivalent to AGTTAACAGACTTTCGGTGCTGG, GGTGACTACCTACGGTGAGTAGG, AATTGGAGTTAACAGACTTTCGG and CCACTCTACCTACTCACCGTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Sedaghatian-type spondylometaphy-seal dysplasia (SSMD). Homozygosity for this allele is embryonic lethal. Compound heterozygosity with an inducible conditional KO allele leads to renal failure (whole body KO) or progressive cortical neurodegeneration (glutamatergic neuron-specific KO). (J:385850)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gpx4 Mutation: 80 strains or lines available

References

• Original: J:385850 Lorenz SM, et al., A fin-loop-like structure in GPX4 underlies neuroprotection from ferroptosis. Cell. 2025 Dec 4
• All: 1 reference(s)