Gpx4em1Marc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gpx4em1Marc |
| Name: |
glutathione peroxidase 4; endonuclease-mediated mutation 1, Marcus Conrad |
| MGI ID: |
MGI:8350465 |
| Synonyms: |
Gpx4R152H |
| Gene: |
Gpx4 Location: Chr10:79883000-79892273 bp, + strand Genetic Position: Chr10, 39.72 cM
|
| Alliance: |
Gpx4em1Marc page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details:
Arginine codon 152 (CGC) was changed to histidine (CAT) (p.R152H) using sgRNAs (equivalent to AGTTAACAGACTTTCGGTGCTGG, GGTGACTACCTACGGTGAGTAGG, AATTGGAGTTAACAGACTTTCGG and CCACTCTACCTACTCACCGTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Sedaghatian-type spondylometaphy-seal dysplasia (SSMD). Homozygosity for this allele is embryonic lethal. Compound heterozygosity with an inducible conditional KO allele leads to renal failure (whole body KO) or progressive cortical neurodegeneration (glutamatergic neuron-specific KO).
(J:385850)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Gpx4 Mutation: |
80 strains or lines available
|
|
| Original: |
J:385850 Lorenz SM, et al., A fin-loop-like structure in GPX4 underlies neuroprotection from ferroptosis. Cell. 2025 Dec 4; |
| All: |
1 reference(s) |
|