Ank3^em1Ruiya
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ank3^em1Ruiya
• Name: ankyrin 3, epithelial; endonuclease-mediated mutation 1, Rui Yang
• MGI ID: MGI:8350146
• Synonyms: Ank3^T1935M
• Gene: Ank3 Location: Chr10:69234608-69863266 bp, + strand Genetic Position: Chr10, 36.1 cM
• Alliance: Ank3^em1Ruiya page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Modified isoform(s))
• Mutation: Single point mutation
• Mutation details: Threonine codon 1860 (ACG), in an alternatively spliced exon in transcript ENSMUST00000182992, was changed to methionine (ATG) (ENSMUSP00000138686:p.T1860M) using sgRNAs (equivalent to GCCCATTAAAACATTGACTACGG and CTCCGTAGTCAATGTTTTAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human Q12955-3:p.T1861M mutation associated with ASD and other neurological impairments and in mice causes some motor and social behavior deficits. (J:385905)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ank3 Mutation: 174 strains or lines available

References

• Original: J:385905 Li M, et al., Impaired AIS plasticity in ankyrin-G mutant mice alters cortical excitability and behavior. Proc Natl Acad Sci U S A. 2025 Dec 2;122(48):e2513363122
• All: 1 reference(s)