Ank3em1Ruiya
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ank3em1Ruiya |
| Name: |
ankyrin 3, epithelial; endonuclease-mediated mutation 1, Rui Yang |
| MGI ID: |
MGI:8350146 |
| Synonyms: |
Ank3T1935M |
| Gene: |
Ank3 Location: Chr10:69234608-69863266 bp, + strand Genetic Position: Chr10, 36.1 cM
|
| Alliance: |
Ank3em1Ruiya page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence, Modified isoform(s)) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
Threonine codon 1860 (ACG), in an alternatively spliced exon in transcript ENSMUST00000182992, was changed to methionine (ATG) (ENSMUSP00000138686:p.T1860M) using sgRNAs (equivalent to GCCCATTAAAACATTGACTACGG and CTCCGTAGTCAATGTTTTAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human Q12955-3:p.T1861M mutation associated with ASD and other neurological impairments and in mice causes some motor and social behavior deficits.
(J:385905)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ank3 Mutation: |
174 strains or lines available
|
|
| Original: |
J:385905 Li M, et al., Impaired AIS plasticity in ankyrin-G mutant mice alters cortical excitability and behavior. Proc Natl Acad Sci U S A. 2025 Dec 2;122(48):e2513363122 |
| All: |
1 reference(s) |
|