Gramd4^em1Mnz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gramd4^em1Mnz
• Name: GRAM domain containing 4; endonuclease-mediated mutation 1, Michel C Nussenzweig
• MGI ID: MGI:8331909
• Synonyms: Gramd4^sp
• Gene: Gramd4 Location: Chr15:85941896-86021835 bp, + strand Genetic Position: Chr15, 40.48 cM
• Alliance: Gramd4^em1Mnz page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: A T-to-G splice site region mutation was introduced (intron 17, ENSMUST00000138134:c.1653+4T>G) using an sgRNA (equivalent to CCAGAAGGTGTGTGCCTGCCCGA) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the allele of the rs235532740 SNP found in the 129P2/OlaHsd , 129S1/SvImJ, 129S5/SvEvBrd, BALB/cJ, CAST/EiJ, LP/J, NZO/HILtJ, PWK/PhJ, and SPRET/EiJ strains and leads to altered splicing, which affects dendritic cell (DC) development in the bone marrow (BM). (J:352176)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gramd4 Mutation: 33 strains or lines available

References

• Original: J:352176 Oliveira TY, et al., Quantitative trait loci mapping provides insights into the genetic regulation of dendritic cell numbers in mouse tissues. Cell Rep. 2024 Jun 25;43(6):114296
• All: 1 reference(s)