About   Help   FAQ
Gramd4em1Mnz
Endonuclease-mediated Allele Detail
Summary
Symbol: Gramd4em1Mnz
Name: GRAM domain containing 4; endonuclease-mediated mutation 1, Michel C Nussenzweig
MGI ID: MGI:8331909
Synonyms: Gramd4sp
Gene: Gramd4  Location: Chr15:85941896-86021835 bp, + strand  Genetic Position: Chr15, 40.48 cM
Alliance: Gramd4em1Mnz page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation details

A T-to-G splice site region mutation was introduced (intron 17, ENSMUST00000138134:c.1653+4T>G) using an sgRNA (equivalent to CCAGAAGGTGTGTGCCTGCCCGA) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the allele of the rs235532740 SNP found in the 129P2/OlaHsd , 129S1/SvImJ, 129S5/SvEvBrd, BALB/cJ, CAST/EiJ, LP/J, NZO/HILtJ, PWK/PhJ, and SPRET/EiJ strains and leads to altered splicing, which affects dendritic cell (DC) development in the bone marrow (BM). (J:352176)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gramd4 Mutation:  33 strains or lines available
References
Original:  J:352176 Oliveira TY, et al., Quantitative trait loci mapping provides insights into the genetic regulation of dendritic cell numbers in mouse tissues. Cell Rep. 2024 Jun 25;43(6):114296
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory