Gramd4em1Mnz
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gramd4em1Mnz |
| Name: |
GRAM domain containing 4; endonuclease-mediated mutation 1, Michel C Nussenzweig |
| MGI ID: |
MGI:8331909 |
| Synonyms: |
Gramd4sp |
| Gene: |
Gramd4 Location: Chr15:85941896-86021835 bp, + strand Genetic Position: Chr15, 40.48 cM
|
| Alliance: |
Gramd4em1Mnz page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
A T-to-G splice site region mutation was introduced (intron 17, ENSMUST00000138134:c.1653+4T>G) using an sgRNA (equivalent to CCAGAAGGTGTGTGCCTGCCCGA) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the allele of the rs235532740 SNP found in the 129P2/OlaHsd , 129S1/SvImJ, 129S5/SvEvBrd, BALB/cJ, CAST/EiJ, LP/J, NZO/HILtJ, PWK/PhJ, and SPRET/EiJ strains and leads to altered splicing, which affects dendritic cell (DC) development in the bone marrow (BM).
(J:352176)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Gramd4 Mutation: |
33 strains or lines available
|
|
| Original: |
J:352176 Oliveira TY, et al., Quantitative trait loci mapping provides insights into the genetic regulation of dendritic cell numbers in mouse tissues. Cell Rep. 2024 Jun 25;43(6):114296 |
| All: |
1 reference(s) |
|