About   Help   FAQ
Nrip1em2Xav
Endonuclease-mediated Allele Detail
Summary
Symbol: Nrip1em2Xav
Name: nuclear receptor interacting protein 1; endonuclease-mediated mutation 2, Ramnik J Xavier
MGI ID: MGI:8325263
Synonyms: Nrip1 KO
Gene: Nrip1  Location: Chr16:76084288-76170715 bp, - strand  Genetic Position: Chr16, 43.65 cM
Alliance: Nrip1em2Xav page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

Arginine codon 448 (CGG) was targeted for change to glycine (GGG) (p.R448G) using an sgRNA (targeting CAGCTTCCGGCTTTTCGATC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human mutation (SNP rs2229742) associated with increased susceptibility to develop Crohns disease (CD). This allele contains an un-targeted 13 bp deletion near the sgRNA target sequence, leading to a frameshift and premature stop codon. (J:382768)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nrip1 Mutation:  195 strains or lines available
References
Original:  J:382768 Chen X, et al., Nuclear receptor coregulator NRIP1 R448G modulates T cell gut homing to control intestinal inflammation. Proc Natl Acad Sci U S A. 2025 Sep 23;122(38):e2508269122
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory