Nrip1^em2Xav
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nrip1^em2Xav
• Name: nuclear receptor interacting protein 1; endonuclease-mediated mutation 2, Ramnik J Xavier
• MGI ID: MGI:8325263
• Synonyms: Nrip1 KO
• Gene: Nrip1 Location: Chr16:76084288-76170715 bp, - strand Genetic Position: Chr16, 43.65 cM
• Alliance: Nrip1^em2Xav page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Arginine codon 448 (CGG) was targeted for change to glycine (GGG) (p.R448G) using an sgRNA (targeting CAGCTTCCGGCTTTTCGATC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human mutation (SNP rs2229742) associated with increased susceptibility to develop Crohns disease (CD). This allele contains an un-targeted 13 bp deletion near the sgRNA target sequence, leading to a frameshift and premature stop codon. (J:382768)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nrip1 Mutation: 195 strains or lines available

References

• Original: J:382768 Chen X, et al., Nuclear receptor coregulator NRIP1 R448G modulates T cell gut homing to control intestinal inflammation. Proc Natl Acad Sci U S A. 2025 Sep 23;122(38):e2508269122
• All: 1 reference(s)