Cmpk2^em2Wjcn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cmpk2^em2Wjcn
• Name: cytidine/uridine monophosphate kinase 2; endonuclease-mediated mutation 2, Wan-Jin Chen
• MGI ID: MGI:8325050
• Synonyms: Cmpk2-KO
• Gene: Cmpk2 Location: Chr12:26519203-26529836 bp, + strand Genetic Position: Chr12, 9.69 cM
• Alliance: Cmpk2^em2Wjcn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The 5' end of exon 1 was targeted using sgRNAs (equivalent to TCGGCCGCGGCGCTTCACTG, AGGGCGCAGCTACGCGCTGT and CCTGACTCACTTCGTCCTGG) with CRISPR/Cas9 technology, resulting in a null allele. (J:383086)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cmpk2 Mutation: 36 strains or lines available

References

• Original: J:383086 Zhao M, et al., Loss of function of CMPK2 causes mitochondria deficiency and brain calcification. Cell Discov. 2022 Nov 29;8(1):128
• All: 1 reference(s)