About   Help   FAQ
Zranb1em1Htran
Endonuclease-mediated Allele Detail
Summary
Symbol: Zranb1em1Htran
Name: zinc finger, RAN-binding domain containing 1; endonuclease-mediated mutation 1, Hoanh Tran
MGI ID: MGI:8322630
Synonyms: Zranb1R438W
Gene: Zranb1  Location: Chr7:132532905-132588127 bp, + strand  Genetic Position: Chr7, 76.32 cM
Alliance: Zranb1em1Htran page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 438 (CGG) was changed to tryptophan (TGG) (p.R438W) using an sgRNA (equivalent to GACTATATGCACTTTGGAAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with small brain size and in mice affects neuronal and glial cell development, leading to motor deficits. (J:353987)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Zranb1 Mutation:  47 strains or lines available
References
Original:  J:353987 Frank D, et al., Trabid patient mutations impede the axonal trafficking of adenomatous polyposis coli to disrupt neurite growth. Elife. 2023 Dec 15;12
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory