Zranb1^em1Htran
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zranb1^em1Htran
• Name: zinc finger, RAN-binding domain containing 1; endonuclease-mediated mutation 1, Hoanh Tran
• MGI ID: MGI:8322630
• Synonyms: Zranb1^R438W
• Gene: Zranb1 Location: Chr7:132532905-132588127 bp, + strand Genetic Position: Chr7, 76.32 cM
• Alliance: Zranb1^em1Htran page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 438 (CGG) was changed to tryptophan (TGG) (p.R438W) using an sgRNA (equivalent to GACTATATGCACTTTGGAAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with small brain size and in mice affects motor neuron and glial cell development, leading to motor deficits. (J:353987)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zranb1 Mutation: 47 strains or lines available

References

• Original: J:353987 Frank D, et al., Trabid patient mutations impede the axonal trafficking of adenomatous polyposis coli to disrupt neurite growth. Elife. 2023 Dec 15;12
• All: 1 reference(s)