Pip4k2b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pip4k2b^em1(IMPC)Tcp
• Name: phosphatidylinositol-5-phosphate 4-kinase, type II, beta; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:8318939
• Gene: Pip4k2b Location: Chr11:97605983-97635530 bp, - strand Genetic Position: Chr11, 61.07 cM
• Alliance: Pip4k2b^em1(IMPC)Tcp page
• IMPC: Pip4k2b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGAAAAGTGTATCTCCCGGG targeting the 5' side and AGGCAGCAGTCGCCCGTCCC targeting the 3' side of a critical region (ENSMUSE00000285484). This resulted in a 1324-bp deletion of Chr11 from 97619933 to 97621256 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pip4k2b Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)