Men1em1Jiez
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Men1em1Jiez |
| Name: |
multiple endocrine neoplasia 1; endonuclease-mediated mutation 1, Jie Zhang |
| MGI ID: |
MGI:8317011 |
| Synonyms: |
Menin-G503D |
| Gene: |
Men1 Location: Chr19:6385009-6390921 bp, + strand Genetic Position: Chr19, 4.45 cM, cytoband A
|
| Alliance: |
Men1em1Jiez page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
Glycine codon 503 (GGC) in exon 10 was changed to aspartic acid (GAC) (p.G503D) using an sgRNA (equivalent to TTGGACAAGGGCCCGGGCTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation (SNP rs375804228) associated with increased major depressive disorder (MDD) risk. Mice carrying this allele also show depression-like behavior.
(J:379428)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Men1 Mutation: |
40 strains or lines available
|
|
| Original: |
J:379428 Leng L, et al., Menin Reduces Parvalbumin Expression and is Required for the Anti-Depressant Function of Ketamine. Adv Sci (Weinh). 2024 Feb;11(5):e2305659 |
| All: |
1 reference(s) |
|