About   Help   FAQ
Men1em1Jiez
Endonuclease-mediated Allele Detail
Summary
Symbol: Men1em1Jiez
Name: multiple endocrine neoplasia 1; endonuclease-mediated mutation 1, Jie Zhang
MGI ID: MGI:8317011
Synonyms: Menin-G503D
Gene: Men1  Location: Chr19:6385009-6390921 bp, + strand  Genetic Position: Chr19, 4.45 cM, cytoband A
Alliance: Men1em1Jiez page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation details

Glycine codon 503 (GGC) in exon 10 was changed to aspartic acid (GAC) (p.G503D) using an sgRNA (equivalent to TTGGACAAGGGCCCGGGCTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation (SNP rs375804228) associated with increased major depressive disorder (MDD) risk. Mice carrying this allele also show depression-like behavior. (J:379428)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Men1 Mutation:  40 strains or lines available
References
Original:  J:379428 Leng L, et al., Menin Reduces Parvalbumin Expression and is Required for the Anti-Depressant Function of Ketamine. Adv Sci (Weinh). 2024 Feb;11(5):e2305659
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory