Men1^em1Jiez
Endonuclease-mediated Allele Detail

Summary

• Symbol: Men1^em1Jiez
• Name: multiple endocrine neoplasia 1; endonuclease-mediated mutation 1, Jie Zhang
• MGI ID: MGI:8317011
• Synonyms: Menin-G503D
• Gene: Men1 Location: Chr19:6385009-6390921 bp, + strand Genetic Position: Chr19, 4.45 cM, cytoband A
• Alliance: Men1^em1Jiez page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glycine codon 503 (GGC) in exon 10 was changed to aspartic acid (GAC) (p.G503D) using an sgRNA (equivalent to TTGGACAAGGGCCCGGGCTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation (SNP rs375804228) associated with increased major depressive disorder (MDD) risk. Mice carrying this allele also show depression-like behavior. (J:379428)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Men1 Mutation: 40 strains or lines available

References

• Original: J:379428 Leng L, et al., Menin Reduces Parvalbumin Expression and is Required for the Anti-Depressant Function of Ketamine. Adv Sci (Weinh). 2024 Feb;11(5):e2305659
• All: 1 reference(s)