About   Help   FAQ
Ccdc93em1Shis
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc93em1Shis
Name: coiled-coil domain containing 93; endonuclease-mediated mutation 1, Shinji Saitoh
MGI ID: MGI:8316987
Synonyms: Ccdc93S631A
Gene: Ccdc93  Location: Chr1:121358796-121434189 bp, + strand  Genetic Position: Chr1, 52.97 cM, cytoband E2
Alliance: Ccdc93em1Shis page
Mutation
origin
Strain of Origin:  C57BL/6NCr
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation details: 

Serine codon 629 (TCC) was changed to alanine (GCC) (p.S629A) using an sgRNA (equivalent to AAAGCCAAGGCCTCCTGAAAACT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the p.S631A (c.1891 T>G) mutation associated with Ritscher-Schinzel syndrome (RSS). (J:379431)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ccdc93 Mutation:  54 strains or lines available
References
Original:  J:379431 Kato K, et al., Ritscher-Schinzel syndrome can be characterized as an endosomal recyclinopathy. Sci Transl Med. 2025 Jul 2;17(805):eadt2426
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory