Ccdc93^em1Shis
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc93^em1Shis
• Name: coiled-coil domain containing 93; endonuclease-mediated mutation 1, Shinji Saitoh
• MGI ID: MGI:8316987
• Synonyms: Ccdc93^S631A
• Gene: Ccdc93 Location: Chr1:121358796-121434189 bp, + strand Genetic Position: Chr1, 52.97 cM, cytoband E2
• Alliance: Ccdc93^em1Shis page

Mutation origin

• Strain of Origin: C57BL/6NCr

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details:

  Serine codon 629 (TCC) was changed to alanine (GCC) (p.S629A) using an sgRNA (equivalent to AAAGCCAAGGCCTCCTGAAAACT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the p.S631A (c.1891 T>G) mutation associated with Ritscher-Schinzel syndrome (RSS). (J:379431)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ccdc93 Mutation: 54 strains or lines available

References

• Original: J:379431 Kato K, et al., Ritscher-Schinzel syndrome can be characterized as an endosomal recyclinopathy. Sci Transl Med. 2025 Jul 2;17(805):eadt2426
• All: 1 reference(s)