About   Help   FAQ
Gm17455em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm17455em1(IMPC)Mbp
Name: predicted gene, 17455; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:8314968
Gene: Gm17455  Location: Chr10:60235643-60239338 bp, + strand  Genetic Position: Chr10, 30.45 cM
Alliance: Gm17455em1(IMPC)Mbp page
IMPC: Gm17455 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation details:  This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GCTTTAGGGGTCCAGAGTAC and TACCTGGAGCAAGCCAATGG that targeted exon(s) ENSMUSE00002182930.1. This resulted in deletion(s) of 577 bp (location: Chr10:60238645-60239221; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gm17455 Mutation:  3 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory