Rab10^em1Bosu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab10^em1Bosu
• Name: RAB10, member RAS oncogene family; endonuclease-mediated mutation 1, Bo Su
• MGI ID: MGI:8288690
• Synonyms: Rab10^T73V
• Gene: Rab10 Location: Chr12:3297428-3359969 bp, - strand Genetic Position: Chr12, 1.71 cM
• Alliance: Rab10^em1Bosu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine codon 73 (ACC) in exon 3 was changed to valine (GTG) (p.T73V) using an sgRNA (equivalent to TCTGTAGTAGGAGGTTGTGATGG) and an ssODN template with CRISPR/Cas9 technology. In the encoded protein the mutation changes a phosphorylatable residue to one that cannot be phosphorylated, which affects neuronal development in the striatum, leading to anxiety-like phenotypes. (J:378281)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rab10 Mutation: 28 strains or lines available

References

• Original: J:378281 Zhang J, et al., Mice with the Rab10 T73V mutation exhibit anxiety-like behavior and alteration of neuronal functions in the striatum. Biochim Biophys Acta Mol Basis Dis. 2023 Jan 18;1869(4):166641
• All: 1 reference(s)