Htr2c^em1Yonxu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Htr2c^em1Yonxu
• Name: 5-hydroxytryptamine (serotonin) receptor 2C; endonuclease-mediated mutation 1, Yong Xu
• MGI ID: MGI:8278435
• Synonyms: Htr2c^F327L
• Gene: Htr2c Location: ChrX:145745509-145980273 bp, + strand Genetic Position: ChrX, 68.46 cM, cytoband D-F4
• Alliance: Htr2c^em1Yonxu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Phenylalanine codon 328 (TTT) was changed to leucine (CTT) (p.F328L) using an sgRNA (equivalent to TTTCATCACCAATATCCTGT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.F327L mutation associated with impaired short-term memory. (J:376997)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Htr2c Mutation: 16 strains or lines available

References

• Original: J:376997 Liu H, et al., Neural circuits expressing the serotonin 2C receptor regulate memory in mice and humans. Sci Adv. 2024 Jun 28;10(26):eadl2675
• All: 1 reference(s)