About   Help   FAQ
Htr2cem1Yonxu
Endonuclease-mediated Allele Detail
Summary
Symbol: Htr2cem1Yonxu
Name: 5-hydroxytryptamine (serotonin) receptor 2C; endonuclease-mediated mutation 1, Yong Xu
MGI ID: MGI:8278435
Synonyms: Htr2cF327L
Gene: Htr2c  Location: ChrX:145745509-145980273 bp, + strand  Genetic Position: ChrX, 68.46 cM, cytoband D-F4
Alliance: Htr2cem1Yonxu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsPhenylalanine codon 328 (TTT) was changed to leucine (CTT) (p.F328L) using an sgRNA (equivalent to TTTCATCACCAATATCCTGT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.F327L mutation associated with impaired short-term memory. (J:376997)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Htr2c Mutation:  15 strains or lines available
References
Original:  J:376997 Liu H, et al., Neural circuits expressing the serotonin 2C receptor regulate memory in mice and humans. Sci Adv. 2024 Jun 28;10(26):eadl2675
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory