Qpctlem1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Qpctlem1(IMPC)Mbp |
| Name: |
glutaminyl-peptide cyclotransferase-like; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:8266933 |
| Gene: |
Qpctl Location: Chr7:18874142-18883121 bp, - strand Genetic Position: Chr7, 9.46 cM, cytoband A2
|
| Alliance: |
Qpctlem1(IMPC)Mbp page
|
| IMPC: |
Qpctl gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AGCATGGTGACGATGCTAAG and GTTGCTACCGAGAAGTATGG that targeted exon(s) ENSMUSE00000198564.2. This resulted in deletion(s) of 14 bp (location: Chr7:18878109-18878122; GRCm39), 1584 bp (location: Chr7:18879666-18881249; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|