Prdx1^em1Xixie
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prdx1^em1Xixie
• Name: peroxiredoxin 1; endonuclease-mediated mutation 1, Xiangyang Xie
• MGI ID: MGI:8266888
• Synonyms: PRDX1^Cys52Ser
• Gene: Prdx1 Location: Chr4:116542796-116557196 bp, + strand Genetic Position: Chr4, 53.28 cM
• Alliance: Prdx1^em1Xixie page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Cysteine codon 52 (TGT) in exon 3 was changed to serine (AGC) (p.C52S) using sgRNAs (equivalent to CCACAGAAGCGCCAATCACT and CCAAGTGATTGGCGCTTCTG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded protein peroxidase-dead, which protects mice from diet-induced liver steatosis and fibrosis (J:363073)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prdx1 Mutation: 37 strains or lines available

References

• Original: J:363073 Bai Z, et al., PRDX1 Cys52Ser variant alleviates nonalcoholic steatohepatitis by reducing inflammation in mice. Mol Metab. 2023 Oct;76:101789
• All: 2 reference(s)