About   Help   FAQ
Prdx1em1Xixie
Endonuclease-mediated Allele Detail
Summary
Symbol: Prdx1em1Xixie
Name: peroxiredoxin 1; endonuclease-mediated mutation 1, Xiangyang Xie
MGI ID: MGI:8266888
Synonyms: PRDX1Cys52Ser
Gene: Prdx1  Location: Chr4:116542796-116557196 bp, + strand  Genetic Position: Chr4, 53.28 cM
Alliance: Prdx1em1Xixie page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCysteine codon 52 (TGT) in exon 3 was changed to serine (AGC) (p.C52S) using sgRNAs (equivalent to CCACAGAAGCGCCAATCACT and CCAAGTGATTGGCGCTTCTG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded protein peroxidase-dead, which protects mice from diet-induced liver steatosis and fibrosis (J:363073)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Prdx1 Mutation:  37 strains or lines available
References
Original:  J:363073 Bai Z, et al., PRDX1 Cys52Ser variant alleviates nonalcoholic steatohepatitis by reducing inflammation in mice. Mol Metab. 2023 Oct;76:101789
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory