About   Help   FAQ
Scn9aem1Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Scn9aem1Ics
Name: sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, Mouse Clinical Institute
MGI ID: MGI:8266439
Synonyms: Scn9aR185H
Gene: Scn9a  Location: Chr2:66310424-66465306 bp, - strand  Genetic Position: Chr2, 39.13 cM
Alliance: Scn9aem1Ics page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 185 (CGT) was changed to histidine (CAT) (p.R185H) using an sgRNA (equivalent to GCCAGTTCCAAGGGTCACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with small chronic pain in fiber neuropathy (SFN) patients and leads to a similar phenotype in mice. (J:363988)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Scn9a Mutation:  124 strains or lines available
References
Original:  J:363988 Xue Y, et al., The Human SCN9A (R185H) Point Mutation Induces Pain Hypersensitivity and Spontaneous Pain in Mice. Front Mol Neurosci. 2022;15:913990
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory