Scn9a^em1Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn9a^em1Ics
• Name: sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:8266439
• Synonyms: Scn9a^R185H
• Gene: Scn9a Location: Chr2:66310424-66465306 bp, - strand Genetic Position: Chr2, 39.13 cM
• Alliance: Scn9a^em1Ics page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 185 (CGT) was changed to histidine (CAT) (p.R185H) using an sgRNA (equivalent to GCCAGTTCCAAGGGTCACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with small chronic pain in fiber neuropathy (SFN) patients and leads to a similar phenotype in mice. (J:363988)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Scn9a Mutation: 124 strains or lines available

References

• Original: J:363988 Xue Y, et al., The Human SCN9A (R185H) Point Mutation Induces Pain Hypersensitivity and Spontaneous Pain in Mice. Front Mol Neurosci. 2022;15:913990
• All: 1 reference(s)