About   Help   FAQ
Nme3em1Zefc
Endonuclease-mediated Allele Detail
Summary
Symbol: Nme3em1Zefc
Name: NME/NM23 nucleoside diphosphate kinase 3; endonuclease-mediated mutation 1, Zee-Fen Chang
MGI ID: MGI:8264618
Synonyms: Nme3 H135Qm
Gene: Nme3  Location: Chr17:25115474-25116496 bp, + strand  Genetic Position: Chr17, 12.53 cM
Alliance: Nme3em1Zefc page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsHistidine codon 135 (CAT) was changed to glutamine (CAG) (p.H135Q) using an sgRNA (equivalent to CCGCACAGGAATGTAATTCA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the catalytic domain of the encoded protein, changes a phosphorylatable residue to one that cannot be phosphorylated, rendering the enzyme kinase-dead, which affects hypoxia-induced mitophagy. (J:374692)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nme3 Mutation:  10 strains or lines available
References
Original:  J:374692 Chen CW, et al., NME3 is a gatekeeper for DRP1-dependent mitophagy in hypoxia. Nat Commun. 2024 Mar 13;15(1):2264
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory