Nme3^em1Zefc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nme3^em1Zefc
• Name: NME/NM23 nucleoside diphosphate kinase 3; endonuclease-mediated mutation 1, Zee-Fen Chang
• MGI ID: MGI:8264618
• Synonyms: Nme3 H135Q^m
• Gene: Nme3 Location: Chr17:25115474-25116496 bp, + strand Genetic Position: Chr17, 12.53 cM
• Alliance: Nme3^em1Zefc page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Histidine codon 135 (CAT) was changed to glutamine (CAG) (p.H135Q) using an sgRNA (equivalent to CCGCACAGGAATGTAATTCA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the catalytic domain of the encoded protein, changes a phosphorylatable residue to one that cannot be phosphorylated, rendering the enzyme kinase-dead, which affects hypoxia-induced mitophagy. (J:374692)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nme3 Mutation: 10 strains or lines available

References

• Original: J:374692 Chen CW, et al., NME3 is a gatekeeper for DRP1-dependent mitophagy in hypoxia. Nat Commun. 2024 Mar 13;15(1):2264
• All: 1 reference(s)