Mcm7^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mcm7^em1(IMPC)Mbp
• Name: minichromosome maintenance complex component 7; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:8261472
• Gene: Mcm7 Location: Chr5:138162845-138170675 bp, - strand Genetic Position: Chr5, 76.97 cM, cytoband G1
• Alliance: Mcm7^em1(IMPC)Mbp page
• IMPC: Mcm7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences ACCCCTAAAAACTAAGAGCT and CTAAGACACAACAACCACTA that targeted exon(s) ENSMUSE00000192150.4 ENSMUSE00000192152.4 ENSMUSE00001245331.2 ENSMUSE00001266585.2 ENSMUSE00001271361.2 ENSMUSE00001293044.2 ENSMUSE00001295826.2. This resulted in deletion(s) of 2225 bp (location: Chr5:138166016-138168240; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mcm7 Mutation: 45 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)