Fam187a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam187a^em1(IMPC)J
• Name: family with sequence similarity 187, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:8259659
• Gene: Fam187a Location: Chr11:102775995-102777557 bp, + strand Genetic Position: Chr11, 66.48 cM
• Alliance: Fam187a^em1(IMPC)J page
• IMPC: Fam187a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences: TCTCCACGATTTCAAAGGCC, CTCCTTCTCCACGATTTCAA, ATTGGCAACAGCAACGACAG and AGTTGGGACAACAGCGAGAT. This resulted in a 1,185 bp deletion of Chr 11:102,885,399 - 102,886,584 (GRCm38/mm10) that removes most of the coding region of exon ENSMUSE00000647300. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam187a Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)