Gt(ROSA)26Sor^{em1(DIS3L)Adki}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(DIS3L)Adki}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Andrzej Dziembowski
• MGI ID: MGI:8239627
• Synonyms: Rosa26(hDIS3L)
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(DIS3L)Adki} page

Mutation origin

• Strain of Origin: (C57BL/6JTar x CBA/WTar)F1

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em1(DIS3L)Adki} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  DIS3L (115752)

  Dis3l

  (MGI:2143272)

• Mutation details: CRISPR-targeting inserted the coding sequence of human DIS3L preceded by an adenoviral splice acceptor (ADSA) with 60 bp homology arms into an intron of the Rosa26 locus (gRNA sequence: CGCCCATCTTCTAGAAAGAC). (J:365445)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1062 strains or lines available

References

• Original: J:365445 Brouze M, et al., DIS3L, cytoplasmic exosome catalytic subunit, is essential for development but not cell viability in mice. RNA. 2025 Feb 7
• All: 1 reference(s)