About   Help   FAQ
Gt(ROSA)26Sorem1(DIS3L)Adki
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(DIS3L)Adki
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Andrzej Dziembowski
MGI ID: MGI:8239627
Synonyms: Rosa26(hDIS3L)
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(DIS3L)Adki page
Mutation
origin
Strain of Origin:  (C57BL/6JTar x CBA/WTar)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Inserted expressed sequence)
Mutation:    Insertion
 
Gt(ROSA)26Sorem1(DIS3L)Adki expresses 1 gene
 
Mutation detailsCRISPR-targeting inserted the coding sequence of human DIS3L preceded by an adenoviral splice acceptor (ADSA) with 60 bp homology arms into an intron of the Rosa26 locus (gRNA sequence: CGCCCATCTTCTAGAAAGAC). (J:365445)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1084 strains or lines available
References
Original:  J:365445 Brouze M, et al., DIS3L, cytoplasmic exosome catalytic subunit, is essential for development but not cell viability in mice. RNA. 2025 Feb 7;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory