Ccdc82em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccdc82em1(IMPC)Tcp |
| Name: |
coiled-coil domain containing 82; endonuclease-mediated mutation 1, Toronto Centre for Phenogenomics |
| MGI ID: |
MGI:8215456 |
| Gene: |
Ccdc82 Location: Chr9:13246573-13292867 bp, + strand Genetic Position: Chr9, Syntenic
|
| Alliance: |
Ccdc82em1(IMPC)Tcp page
|
| IMPC: |
Ccdc82 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CAGAGTCCTAATTAAATGAG and TTTTATACTAATGATCCCCC that targeted exon(s) ENSMUSE00000684468.2 ENSMUSE00001468758.2 ENSMUSE00002084385.1 ENSMUSE00002084392.1. This resulted in deletion(s) of 402 bp (location: Chr9:13252842-13253243; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|