Mmp9^em1Iimcb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mmp9^em1Iimcb
• Name: matrix metallopeptidase 9; endonuclease-mediated mutation 1, Olga Gewartowska
• MGI ID: MGI:8209555
• Synonyms: Mmp9 UTRmut
• Gene: Mmp9 Location: Chr2:164782700-164797770 bp, + strand Genetic Position: Chr2, 85.27 cM, cytoband H1-H2
• Alliance: Mmp9^em1Iimcb page

Mutation origin

• Strain of Origin: C57BL/6 x CBA

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: A miR132 binding site in the 3' UTR was modified using an sgRNA (equivalent to TGCCCACCGTCCTTTCTTGT) and an ssODN template with CRISPR/Cas9 technology, changing part of it from GGACTGT to AACTCAC. This abolishes miR132 binding. (J:364028)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mmp9 Mutation: 48 strains or lines available

References

• Original: J:364028 Kuzniewska B, et al., Disrupting interaction between miR-132 and Mmp9 3'UTR improves synaptic plasticity and memory in mice. Front Mol Neurosci. 2022;15:924534
• All: 1 reference(s)