About   Help   FAQ
Stat5bem1Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Stat5bem1Mam
Name: signal transducer and activator of transcription 5B; endonuclease-mediated mutation 1, Lothar Hennighausen
MGI ID: MGI:8204544
Synonyms: STAT5BY665H
Gene: Stat5b  Location: Chr11:100671557-100741407 bp, - strand  Genetic Position: Chr11, 63.63 cM
Alliance: Stat5bem1Mam page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 665 (TAC) was changed to histidine (CAC) (p.Y665H) using an sgRNA (targeting TGAGGTAATTCAGGTCCCCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SH2 domain of the encoded protein, is the equivalent of the same human mutation associated with T-cell large granular lymphoblastic leukemia (T-LGLL) and T-cell prolymphocytic leukemia (T-PLL). Y665H replaces the 6-membered ring with a 5-membered imidazole ring that is positively charged at physiological pH, possibly destabilizing the fold of the monomer, conceivably causing loss-of-function. (J:365015)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Stat5b Mutation:  33 strains or lines available
References
Original:  J:365015 Lee HK, et al., Disease-Associated Mutations of the STAT5B SH2 Domain Regulate Cytokine-Driven Enhancer Function and Mammary Development. J Mammary Gland Biol Neoplasia. 2025 Mar 31;30(1):7
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory