About   Help   FAQ
Tpm4em1Hrd
Endonuclease-mediated Allele Detail
Summary
Symbol: Tpm4em1Hrd
Name: tropomyosin 4; endonuclease-mediated mutation 1, Edna C Hardeman
MGI ID: MGI:8192458
Synonyms: Tpm4.2
Gene: Tpm4  Location: Chr8:72889132-72906986 bp, + strand  Genetic Position: Chr8, 34.81 cM
Alliance: Tpm4em1Hrd page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

CRISPR/Cas9-targeting using two sgRNAs (targeting CAGAACGATTGAGCTATGGC and GCAGCGCGAACTGGATGGCG) generated a 94-bp deletion that includes the ATG start codon. Western blot analysis confirmed the absence of protein. TPM4.2 refers to the single isoform in mouse, while human has this short isoform as well as a longer isoform, TPM4.1. (J:242938)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tpm4 Mutation:  12 strains or lines available
References
Original:  J:242938 Pleines I, et al., Mutations in tropomyosin 4 underlie a rare form of human macrothrombocytopenia. J Clin Invest. 2017 Mar 01;127(3):814-829
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory