About   Help   FAQ
Lactbem1Susz
Endonuclease-mediated Allele Detail
Summary
Symbol: Lactbem1Susz
Name: lactamase, beta; endonuclease-mediated mutation 1, Katalin Susztak
MGI ID: MGI:8187926
Gene: Lactb  Location: Chr9:66862668-66882706 bp, - strand  Genetic Position: Chr9, 36.23 cM, cytoband D
Alliance: Lactbem1Susz page
Mutation
origin
Strain of Origin:  (C57BL/6 x SJL)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 mediated recombination created a null allele. sgRNAs (CTAGAAAGGAGACGAGGACC and GCCGCGGGCTGACGCTCTTA) were designed to target exon 1 of the lactamase, beta (Lactb) gene. The resultig alelle have have the 586 bp in exon 1 deleted. Immunoblot analysis confirmed the absence of expression in kidneys from homozygous mice. (J:101977, J:359729)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lactb Mutation:  24 strains or lines available
References
Original:  J:359729 Li S, et al., Human genetics identify convergent signals in mitochondrial LACTB-mediated lipid metabolism in cardiovascular-kidney-metabolic syndrome. Cell Metab. 2024 Nov 14;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory