Otud3^em2Yxy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Otud3^em2Yxy
• Name: OTU domain containing 3; endonuclease-mediated mutation 2, Yuxin Yin
• MGI ID: MGI:8169786
• Synonyms: Otud3^-
• Gene: Otud3 Location: Chr4:138622690-138641256 bp, - strand Genetic Position: Chr4, 70.57 cM, cytoband D3
• Alliance: Otud3^em2Yxy page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (equivalent to GACCAGTTGGAGGGCCACTCT) targeting exon 2, created an deletion-insertion event that replaced CCACTCTCGGAACCATCTCAAGCATCG in exon 2 with ACTGC, leading to frameshift and premature stop codon (p.H87Lfs*9). (J:351461)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Otud3 Mutation: 23 strains or lines available

References

• Original: J:351461 Zhou N, et al., Deubiquitinase OTUD3 regulates metabolism homeostasis in response to nutritional stresses. Cell Metab. 2022 Jul 5;34(7):1023-1041.e8
• All: 1 reference(s)