Trgv7^em2Dmuc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trgv7^em2Dmuc
• Name: T cell receptor gamma, variable 7; endonuclease-mediated mutation 2, Daniel Mucida
• MGI ID: MGI:8161695
• Gene: Trgv7 Location: Chr13:19362212-19362662 bp, + strand Genetic Position: Chr13, 6.89 cM
• Alliance: Trgv7^em2Dmuc page

Mutation origin

• Strain of Origin: C57BL/6J-Trgc4^em1Dmuc/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: sgRNA (ACUGGUACCGAUUCCAGAAAGGG) and cas9 protein were injected into Vg1KO embryos to create a 166 bp deletion in exon 2 of the mouse Trgv7 gene. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trgv7 Mutation: 7 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)