About   Help   FAQ
Rr598em2Yagk
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr598em2Yagk
Name: regulatory region 598; endonuclease-mediated mutation 2, Yana G Kamberov
MGI ID: MGI:7856494
Synonyms: mECE18KO mECE20KO
Gene: Rr598  Location: unknown  Genetic Position: Chr1, Syntenic
Alliance: Rr598em2Yagk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to CAGAATCAATATAAGCCCCAGGG and TTCTTCCGGACCATGGACTAGGG) with CRISPR/Cas9 technology, resulting in a 1486 bp deletion (GRCm39:chr1:121024265-121025750). This allele was created in zygotes carrying the Rr597em1Yagk ECE20 KO allele. (J:333368)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr598 Mutation:  0 strains or lines available
References
Original:  J:333368 Aldea D, et al., Differential modularity of the mammalian Engrailed 1 enhancer network directs sweat gland development. PLoS Genet. 2023 Feb;19(2):e1010614
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory