About   Help   FAQ
Rr597em1Yagk
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr597em1Yagk
Name: regulatory region 597; endonuclease-mediated mutation 1, Yana G Kamberov
MGI ID: MGI:7855976
Synonyms: mECE20KO
Gene: Rr597  Location: unknown  Genetic Position: Chr1, Syntenic
Alliance: Rr597em1Yagk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to AAGGAACCACATCGCAAAGAGGG and CCGGGCCTCGGCCACTACTCGGG) with CRISPR/Cas9 technology, resulting in a 1674 bp deletion (GRCm39:chr1:121104405-121106078). Expression of En1 is severely reduced in mid-hindbrain and moderately reduced in palm (volar) skin. (J:333368)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr597 Mutation:  0 strains or lines available
References
Original:  J:333368 Aldea D, et al., Differential modularity of the mammalian Engrailed 1 enhancer network directs sweat gland development. PLoS Genet. 2023 Feb;19(2):e1010614
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory