About   Help   FAQ
Rr594em2Mrub
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr594em2Mrub
Name: regulatory region 594; endonuclease-mediated mutation 2, Marcelo Rubinstein
MGI ID: MGI:7855638
Synonyms: delta1delta2delta3, PomcdeltanPE1.deltanPE2.deltanPE3
Gene: Rr594  Location: unknown  Genetic Position: Chr12, Syntenic
Alliance: Rr594em2Mrub page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Deletion
 
Mutation detailsHypothalamic neuron-specific Pomc enhancer nPE3, located upstream, was targeted using sgRNAs (equivalent to CCTGTGTGGACGCCCGCCTGAGG and TCCTTCAGCTGGTTCCAAGGAGG) with CRISPR/Cas9 technology, resulting in its deletion. This allele was created in zygotes heterozygous for the Rr596tm1.1Low allele (where enhancers Rr279 (nPE1) and Rr280 (nPE2) are deleted). Eight founder mice were created, with four different deletions and one deletion-insertion amongst them. A founder strain carrying a 634 bp deletion (GRCm39:chr12:3986460-3987093)of nPE3 (Rr594) in addition to the Rr596tm1.1Low allele was selected. (J:357475)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr594 Mutation:  0 strains or lines available
References
Original:  J:357475 Rojo D, et al., A mammalian tripartite enhancer cluster controls hypothalamic Pomc expression, food intake, and body weight. Proc Natl Acad Sci U S A. 2024 Apr 30;121(18):e2322692121
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory