About   Help   FAQ
Cd55bem1Cys
Endonuclease-mediated Allele Detail
Summary
Symbol: Cd55bem1Cys
Name: CD55 molecule, decay accelerating factor for complement B; endonuclease-mediated mutation 1, Jason G Cyster
MGI ID: MGI:7840412
Gene: Cd55b  Location: Chr1:130316274-130350746 bp, - strand  Genetic Position: Chr1, 56.89 cM
Alliance: Cd55bem1Cys page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-cas9 mediated recombination using guide RNAs (CTGGCATTAGGAATGTCTGG and TCTGTCTTGAAAATGGCCAA) created a 139 bp deletion in exon 2 in the Cd55b gene. The identical sequence was also deleted in the Cd55 gene resulting in Cd55em1Cysi allele. (J:101977, J:324874)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cd55b Mutation:  30 strains or lines available
References
Original:  J:324874 Liu D, et al., CD97 promotes spleen dendritic cell homeostasis through the mechanosensing of red blood cells. Science. 2022 Feb 11;375(6581):eabi5965
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory