Pold1^em1Ewht
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pold1^em1Ewht
• Name: polymerase (DNA directed), delta 1, catalytic subunit; endonuclease-mediated mutation 1, Eileen White
• MGI ID: MGI:7797727
• Synonyms: Pold1 D400A, Pold1^D400A
• Gene: Pold1 Location: Chr7:44182168-44198239 bp, - strand Genetic Position: Chr7, 28.83 cM
• Alliance: Pold1^em1Ewht page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (equivalent to CCCGAGAGATGAGGTATGGG) and an ssODN template with CRISPR/Cas9 technology, the endonuclease domain of the gene was targeted, resulting in the change of codon 400 from aspartic acid (GAC) to alanine (GCA) (g.GRCm39:chr7:44189985_44189986GT>TG, p.D400A). (J:364251)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pold1 Mutation: 61 strains or lines available

References

• Original: J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
• All: 2 reference(s)