About   Help   FAQ
Pold1em1Ewht
Endonuclease-mediated Allele Detail
Summary
Symbol: Pold1em1Ewht
Name: polymerase (DNA directed), delta 1, catalytic subunit; endonuclease-mediated mutation 1, Eileen White
MGI ID: MGI:7797727
Synonyms: Pold1 D400A, Pold1D400A
Gene: Pold1  Location: Chr7:44182168-44198239 bp, - strand  Genetic Position: Chr7, 28.83 cM
Alliance: Pold1em1Ewht page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (equivalent to CCCGAGAGATGAGGTATGGG) and an ssODN template with CRISPR/Cas9 technology, the endonuclease domain of the gene was targeted, resulting in the change of codon 400 from aspartic acid (GAC) to alanine (GCA) (g.GRCm39:chr7:44189985_44189986GT>TG, p.D400A). (J:364251)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pold1 Mutation:  61 strains or lines available
References
Original:  J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory