Pold1^em1Ewht
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pold1^em1Ewht
• Name: polymerase (DNA directed), delta 1, catalytic subunit; endonuclease-mediated mutation 1, Eileen White
• MGI ID: MGI:7797727
• Synonyms: Pold1 D400A
• Gene: Pold1 Location: Chr7:44182168-44198239 bp, - strand Genetic Position: Chr7, 28.83 cM
• Alliance: Pold1^em1Ewht page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR technology, a sgRNA (CCCGAGAGATGAGGTATGGG) was designed to target the endonuclease domain of the Pold1 gene to introduce GAC to GCA mutations resulting in an aspartic acid to alanine change at amino acid 400 (D400A). (J:364251)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pold1 Mutation: 60 strains or lines available

References

• Original: J:364251 Sawant A, et al., Immune Checkpoint Blockade Delays Cancer Development and Extends Survival in DNA Polymerase Mutator Syndromes. Cancer Res. 2025 Mar 14;85(6):1130-1144
• All: 1 reference(s)