Pqbp1^em1Jhhan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pqbp1^em1Jhhan
• Name: polyglutamine binding protein 1; endonuclease-mediated mutation 1, Junhai Han
• MGI ID: MGI:7797303
• Synonyms: Pqbp1^W215X
• Gene: Pqbp1 Location: ChrX:7760759-7765469 bp, - strand Genetic Position: ChrX, 3.56 cM
• Alliance: Pqbp1^em1Jhhan page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Single point mutation
• Mutation details: Tryptophan codon 215 (TGG) in exon 5 was changed to a stop codon (TGA) (NM_001252528.1:c.645G>A:p.W215*) using an sgRNA (equivalent to CTCTTGTCCCCAGGGGCACA) and an ssODN template (CTCCACCCTCTTCCTGTACTCTAATTCTCTCTTGTCCCCAGGGGCACATGATCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGT) with CRISPR/Cas9 technology, creating a stop codon in the last exon 49 codons upstream of the endogenous stop codon. This mutation is the equivalent of the human p.W217* mutation found in some Chinese Han children with severe intellectual disability. (J:353600)

Expression

In Mice Carrying this Mutation:	7 assay results
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pqbp1 Mutation: 4 strains or lines available

References

• Original: J:353600 Liu X, et al., Dynamic regulation of alternative polyadenylation by PQBP1 during neurogenesis. Cell Rep. 2024 Aug 27;43(8):114525
• All: 1 reference(s)