About   Help   FAQ
Pqbp1em1Jhhan
Endonuclease-mediated Allele Detail
Summary
Symbol: Pqbp1em1Jhhan
Name: polyglutamine binding protein 1; endonuclease-mediated mutation 1, Junhai Han
MGI ID: MGI:7797303
Synonyms: Pqbp1W215X
Gene: Pqbp1  Location: ChrX:7760759-7765469 bp, - strand  Genetic Position: ChrX, 3.56 cM
Alliance: Pqbp1em1Jhhan page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsTryptophan codon 215 (TGG) in exon 5 was changed to a stop codon (TGA) (NM_001252528.1:c.645G>A:p.W215*) using an sgRNA (equivalent to CTCTTGTCCCCAGGGGCACA) and an ssODN template (CTCCACCCTCTTCCTGTACTCTAATTCTCTCTTGTCCCCAGGGGCACATGATCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGT) with CRISPR/Cas9 technology, creating a stop codon in the last exon 49 codons upstream of the endogenous stop codon. This mutation is the equivalent of the human p.W217* mutation found in some Chinese Han children with severe intellectual disability. (J:353600)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 7 assay results
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pqbp1 Mutation:  4 strains or lines available
References
Original:  J:353600 Liu X, et al., Dynamic regulation of alternative polyadenylation by PQBP1 during neurogenesis. Cell Rep. 2024 Aug 27;43(8):114525
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory