Rr590^em1Pike
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr590^em1Pike
• Name: regulatory region 590; endonuclease-mediated mutation 1, J Wesley Pike
• MGI ID: MGI:7790911
• Synonyms: M21-IKO
• Gene: Rr590 Location: unknown Genetic Position: Chr10, Syntenic
• Alliance: Rr590^em1Pike page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Cyp27b1 enhancer, located in an Eef1akmt3 (Mettl21b) intron, was targeted using sgRNAs (equivalent to CCTACCTTCCCGCTACTGTTGGG and CCCTTCCTTAGGGACTTCATGGG) with CRISPR/Cas9 technology, resulting in a 5460 bp deletion (GRCm39:chr10:126868979-126874438) that includes the start of the coding last Eef1akmt3 exon. (J:281102)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr590 Mutation: 0 strains or lines available

References

• Original: J:281102 Meyer MB, et al., Targeted genomic deletions identify diverse enhancer functions and generate a kidney-specific, endocrine-deficient Cyp27b1 pseudo-null mouse. J Biol Chem. 2019 Jun 14;294(24):9518-9535
• All: 3 reference(s)